Recentemente, foi criado um sistema que emprega moléculas sintéticas de DNA para armazenar dados de textos, imagens ou vídeos simples. Nesse sistema, qualquer trecho compreendido entre 5 bases A na sequência da molécula sintética de DNA é chamado códex, o qual tem a estrutura genérica abaixo.

A primeira base de cada códex é o pixet, que indica qual das três linhas de pixels da imagem o códex representa: G indica a primeira linha (1), C indica a segunda linha (2) e T indica a terceira linha (3). Após o pixet, o códex inclui 19 conjuntos de duas bases (dupletos), nomeados de a até s; cada dupleto representa um pixel gráfico na imagem.

Por exemplo, a imagem abaixo foi codificada pela sequência de DNA a seguir (apenas a sequência de uma das fitas de DNA é apresentada):

AAAAACTTTATTTTCCTTTTTTACACTTGGTTTTGTGTTTGGTTAAAAATCCTTTGTTAGCCTTCCTTTTTTCATTTTGTGTTTAGAGAAAAAGTTTATTTTCGTTTTTCGCGCTCGCCGTTCGCGTTGCCGAAAAA.

a) Qual a sequência de bases do dupleto que representa os pixels do tipo ? Explique, em termos da deterioração da imagem, por que a inserção de uma base extra logo após o primeiro dupleto de um códex da sequência de DNA acima é mais grave que a deleção do último dupleto desse códex.

b) Compare o funcionamento dos dupletos do sistema descrito acima com o funcionamento dos códons na codificação de aminoácidos em organismos vivos. Qual organela catalisa o processo de tradução?

a) A sequência do dupleto solicitado é CG.
A inserção de uma base extra mudará a leitura dos dupletes a partir daquele ponto, provocando uma deterioração total daquela linha, enquanto a deleção do último dupleto só provocará a falta de um pixel.

b) O dupleto determina um pixel na imagem da mesma forma que um códon determina um aminoácido na proteína.
a organela que catalisa a tradução é o ribossomo.